
Reference files
What is a reference file
A Genozip reference file is a file with a .ref.genozip file name extension. It is derived from a set of genomic sequences retrieved from one or more FASTA files. These sequences represent the genome(s) of the organism(s) from which the data to-be-compressed originated.
genozip uses the reference file to better compress files that contain genomic sequences, essentially by storing the location in the reference file containing the sequence at hand rather than storing the sequence itself, thereby obtaining a smaller representation of the data – the essence of compression.
A reference file is useful for compressing these file types:
- FASTQ files.
- SAM / BAM / CRAM files.
- VCF files - this is particularly effective for certain types of VCF files.
- Certain types of FASTA files (details).
- A reference file is also needed for converting 23andMe format to VCF format.
While Genozip can always compress without using a reference, if one is available, it is a good idea to use it – the compression will be better, and also faster. In particular, the effect is dramatic on FASTQ files and unmapped SAM / BAM / CRAM files – these, really, should always be compressed using a reference file.
Making a reference file
A reference file is made like this:
$ genozip --make-reference hs37d5.fa.gz
It can also be made from a URL:
$ genozip --make-reference ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/
reference/phase2_reference_assembly_sequence/hs37d5.fa.gz
Multi-organism reference files
If your file contains reads from multiple organisms, a situation common, for example, in Single Cell RNA and in environmental DNA, it is advisable to create reference files containing all expected organisms:
$ cat organismA.fa.gz organismB.fa.gz | genozip --make-reference - --output myref.ref.genozip
Genozip supports references of up to 1 Tbps (~ 1 trillion bases), but if you plan on using references larger than 10 Gbps or so we advise contacting support@genozip.com to discuss.
Note: Genozip expects contig names to be unique, and will error if they are not.
Reference file sizes
When making a reference file you may optionally specify a size parameter, for example:
$ genozip --make-reference=large hs37d5.fa.gz
The available sizes are tiny, small, medium and large (default: medium). The size impacts compression of FASTQ, FASTA and unmapped reads within SAM / BAM / CRAM, by controlling the number entries in the hash table. A larger size results in better and also faster compression, at the cost of more RAM (shared memory) consumption and a larger reference file size on disk.
Note: Genozip sizes the hash table within a reference file according to the size of genome(s). The hash table size reaches its maximum size for genome(s) of 32 Gbp and grows no further for larger genomes. This size parameter increases or decreases the hash table size relative to this size calculated based on the genome size. Therefore, there is no need to use this parameter Just because the genome is large or small.
A special size is minimal - a minimal reference file contains no hash table at all and therefore cannot be used to compress FASTQ, FASTA and unmapped SAM/BAM/CRAM files, but can be used to compress all other file types, and can be used to uncompress all files (including FASTQ etc).
Using hs37d5 (a common human genome reference file) as an example, these are the sizes for this particular reference file:
file size shared memory (RAM)
minimal 693 MB 0.73 GB
tiny 1.2 GB 1.23 GB
small 1.5 GB 1.73 GB
medium 1.9 GB 2.73 GB
large 2.2 GB 4.73 GB
Using a reference file
The most common way of using a reference file is in external reference mode, as this achieves the best compression, for example:
$ genozip --reference hs37d5.ref.genozip myfile-R1.fq.gz
In this mode, no data from the reference file is copied into the compressed file. Instead, the reference file is needed again to uncompress the data with genounzip or genocat:
$ genounzip --reference hs37d5.ref.genozip myfile-R1.fq.genozip
The --reference option may be omitted in genounzip and genocat in which case the reference file will be sought in the same location on the filesystem as was used when the file was generated with genozip.
In contrast, in the stored reference mode, the parts of the reference data that are actually referenced by the file being compressed are stored in the compressed file itself, adding about 0.23 bytes per reference base to its size. For example, for a human WGS FASTQ or BAM file, this would increase the compressed file size by about 700 MB.
$ genozip --REFERENCE hs37d5.ref.genozip myfile-R1.fq.gz
The advantage is that the reference file is not needed to uncompress:
$ genounzip myfile-R1.fq.genozip
Note that the --reference and --REFERENCE command line options can also take a FASTA file name as an argument, instead of a .ref.genozip file. This is just a shortcut for convenience: Genozip searches for the corresponding .ref.genozip in the same directory as the FASTA, and if not found, it makes it.
Using $GENOZIP_REFERENCE: this environment variable can be set to the path of a reference file, which will be used by genozip, genounzip or genocat if the --reference option is omitted, as an external reference. For genounzip and genocat (but not genozip), it can also be set to a directory name, in which case the reference file used by genozip to generate the compressed file, will be sought in that directory.
In-memory caching of reference files
Since reference files are RAM-hungry and take a few seconds to load, genozip caches them in shared memory. This way, all concurrent genozip processes share the same reference in memory, thereby saving RAM. Also, it saves time, because loading the reference file from disk occurs only the first time a particular reference file is used.
The reference data remains in RAM until it is removed: either explicitly (see below) or automatically: any genozip process that runs also removes cached reference files that have not been used in 24 hours.
To see the references currently cached in memory:
$ genols --cache
shmid owner perm size loaded name
2 divon 666 2797630464 2026-04-01 8:46:39 hs37d5.ref.genozip
3 divon 666 2817628528 2026-04-09 23:39:47 GRCh38.ref.genozip
Note: shared memory permissions (seen in the perm column) are inherited from the reference file, and the owner is the user to ran genozip or genounzip causing the caching of the reference file.
Note: genols --cache peeks into the reference caches, thereby reseting the countdown to their automatic removal after 24 hours of non-use.
To remove a cached reference file from memory:
$ genozip --no-cache
genozip: Unloading reference cache "hs37d5.ref.genozip"
genozip: Unloading reference cache "GRCh38.ref.genozip"
Removing a single cached reference from memory:
$ genozip --no-cache --reference hs37d5.ref.genozip
The actual removal of these shared memory segments will occur after all processes currently running and using the reference data have completed.
It is possible to instruct Genozip to load a copy of the reference from directly from disk, i.e. without attempting to load it from the cache, and without storing it there:
$ genozip --reference hs37d5.ref.genozip --no-cache myfile-R1.fq.gz
Assessing whether a reference file may be used with a particular FASTQ or BAM
There are times where the organism is not known at compression time. Genozip can assess whether a particular reference file would match the FASTQ or BAM data.
$ genozip --reference mouse.ref.genozip human-dna.fq.gz --assess-reference
ℹ️ Based on the first 713 reads of human-dna.fq.gz : the estimated percent of reads covered by mouse.ref.genozip is 27.9%
$ echo $?
1
$ genozip --reference hs37d5.ref.genozip human-dna.fq.gz --assess-reference
ℹ️ Based on the first 713 reads of human-dna.fq.gz: the estimated percent of reads covered by hs37d5.ref.genozip is 97.8%
$ echo $?
0
An exit status of 1 is returned if the reference file is not a good fit:
- For FASTQ: if it is estimated that less than 90% of the FASTQ reads are covered by the reference file.
- For BAM: if a contig listed in the SAM header has a different length than the same contig in the reference file, or if a major contig (defined as longer than 1 Mb) listed in the SAM header is missing in the reference file. Note that Genozip is tolerant of common variations in contig names, such as "1" ⇔ "chr1".
This might useful for scripting, for example:
$ if genozip -e hs37d5.ref.genozip human-dna.fq.gz --assess-reference --quiet; then echo "ALL GOOD"; fi
ALL GOOD
Note: assessed reference files remain cached in RAM (see: In-memory caching of reference files).
Note on Docker containers and caching of reference files
In order to avoid loading the reference file from disk with each execution in a Docker container and having multiple copies of the reference consuming RAM if multiple containers are running Genozip in parallel, it is advisable to share the shared memory between docker containers. Luckily, Docker allows doing just that using docker run --ipc.
One strategy is to have a docker container which holds the reference, and the other containers using it. To load reference data into cache, compress a tiny dummy file:
$ genozip --force --no-test --reference hs37d5.ref.genozip tiny.fq
Note on Windows and caching of reference files
Automatic removal of cached reference files after 24 hours of non-use does not work for Windows, and therefore the reference data remains in memory until removed with genozip --no-cache or Windows is restarted.
Viewing and subsetting the reference data
In addition to their primary use for compressing files, reference files are also useful for analyzing the genome contained within:
⇒ See properties of the contigs with --print-ref-contigs:
$ genocat --print-ref-contigs hs37d5.ref.genozip
"1" length=249250621 ref_index=0 gpos=0
"2" length=243199373 ref_index=1 gpos=249250624
"3" length=198022430 ref_index=2 gpos=492450048
"4" length=191154276 ref_index=3 gpos=690472512
"5" length=180915260 ref_index=4 gpos=881626816
"6" length=171115067 ref_index=5 gpos=1062542080
...
⇒ View sub-sequences of contigs in certain regions (forward or reverse complemented) using --regions and --regions-file:
51 bases of chromosome 1, starting at 1000000:
$ genocat --reference hs37d5.ref.genozip --regions 1:1000000-1000050
1000000-1000050 TGGGCACAGCCTCACCCAGGAAAGCAGCTGGGGGTCCACTGGGCTCAGGGA
The same sequence, using the +length notation:
$ genocat --reference hs37d5.ref.genozip --regions 1:1000000+51
1000000-1000050 TGGGCACAGCCTCACCCAGGAAAGCAGCTGGGGGTCCACTGGGCTCAGGGA
The same sequence reverse complemented, using the –length notation:
$ genocat --reference hs37d5.ref.genozip --regions 1:1000050-51
COMPLEM 1000050-1000000 TCCCTGAGCCCAGTGGACCCCCAGCTGCTTTCCTGGGTGAGGCTGTGCCCA
⇒ Find IUPAC non-ACGTN pseudo-bases in the data with --print-ref-iupacs:
$ genocat --reference hs37d5.ref.genozip --print-ref-iupacs
IUPACs found in hs37d5.ref.genozip:
IUPAC=M CHROM=3 POS=60830534 GPOS=553280581
IUPAC=R CHROM=3 POS=60830763 GPOS=553280810
IUPAC=R CHROM=3 POS=60830764 GPOS=553280811
IUPAC=W CHROM=hs37d5 POS=31435586 GPOS=3133414593
IUPAC=V CHROM=hs37d5 POS=31437595 GPOS=3133416602
...
See more here: Reference file options.
Note on backwards compatibility of reference files
Genozip version 15, the current version, is able to use reference files made by older versions - as old as Genozip version 8. However, a sequence of major improvements occurred to Genozip reference file technology over time, and it is highly recommended to use a reference file made by genozip 15.0.81 and above which provide much faster and better compression.
Files compressed with a reference file made by Genozip version 15, can be uncompressed with any other reference file made by Genozip version 15 from the same FASTA file regardless of the size parameter used in --make-reference (as long as the reference file was not made by a newer version of Genozip than the version trying to use it).
To find out which Genozip version was used to make a particular reference file, use:
$ genocat --stats myref.ref.genozip
Genozip's backward compatibility of reference files notwithstanding, the best practice is to store the reference file used to compress together with the archive of compressed files, and to use the same reference file to uncompress.
